De novo Chimera Detection

Overview

The rchime() function allows you to detect and remove chimeric sequences using the dataset as it’s own reference (de novo). The denovo approach is our preferred method for removing chimeras. rchime() can be used with strollur objects or data.frames as inputs. Let’s look at examples of both data types using sequence data from mothur’s MiSeq_SOP example analysis.

Creating strollur objects

fasta_data <- readRDS(rchime_example("miseq_fasta.rds"))
abundance_data <- readRDS(rchime_example("miseq_abundance.rds"))

strollur <- strollur::new_dataset("rchime de novo example")

strollur::add(strollur, table = fasta_data, type = "sequence")
#> Added 6084 sequences.
strollur::assign(strollur, table = abundance_data, type = "sequence_abundance")
#> Assigned 6084 sequence abundances.

strollur
#> rchime de novo example:
#> 
#>             starts ends nbases ambigs polymers numns   numseqs
#> Minimum:         1  249    249      0        3     0      1.00
#> 2.5%-tile:       1  252    252      0        4     0   3216.38
#> 25%-tile:        1  252    252      0        4     0  32163.75
#> Median:          1  253    253      0        4     0  64327.50
#> 75%-tile:        1  253    253      0        5     0  96491.25
#> 97.5%-tile:      1  254    254      0        6     0 125438.62
#> Maximum:         1  256    256      0        8     0 128655.00
#> Mean:            1  252    252      0        4     0  64327.64
#> 
#> Number of unique seqs: 6084 
#> Total number of seqs: 128655 
#> 
#> Total number of samples: 20

Loading data.frames

df <- readRDS(rchime_example("miseq_data_frame_by_sample.rds"))

str(df)
#> 'data.frame':    11039 obs. of  4 variables:
#>  $ sequence_name: chr  "M00967_43_000000000-A3JHG_1_1101_10133_8460" "M00967_43_000000000-A3JHG_1_1101_10133_8460" "M00967_43_000000000-A3JHG_1_1101_10133_8460" "M00967_43_000000000-A3JHG_1_1101_10133_8460" ...
#>  $ sequence     : chr  "TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCCATGCAAGTCAGAAGTGAAAACCCGGGGCTCAACCCTGGGAGTGCTTTTGAAACT"| __truncated__ "TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCCATGCAAGTCAGAAGTGAAAACCCGGGGCTCAACCCTGGGAGTGCTTTTGAAACT"| __truncated__ "TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCCATGCAAGTCAGAAGTGAAAACCCGGGGCTCAACCCTGGGAGTGCTTTTGAAACT"| __truncated__ "TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCCATGCAAGTCAGAAGTGAAAACCCGGGGCTCAACCCTGGGAGTGCTTTTGAAACT"| __truncated__ ...
#>  $ sample       : chr  "F3D2" "F3D146" "F3D149" "F3D150" ...
#>  $ abundance    : int  222 1 1 1 127 17 32 13 95 86 ...

Removing chimeras

When removing chimeras using the de novo method, the potential parents are chosen from more abundant sequences in your dataset.

Before we remove the chimeras let’s discuss the dereplicate parameter. When dereplicate=FALSE, if a sequence is flagged as chimeric in one sample, it is removed from all samples. Our experience suggests that this is a bit aggressive since we’ve seen rare sequences get flagged as chimeric when they’re the most abundant sequence in another sample. For a more conservative approach, we recommend using the default dereplicate=TRUE which will only remove sequences from the samples in which they are flagged as chimeric. Let’s use the de novo method to remove the chimeras.

rchime(strollur)
#> ℹ The de novo method runs with a single processor.
#> → rchime removed `10453` chimeras from your dataset.
#> → It took `4.49747085571289` seconds to detect and remove the chimeras.
strollur
#> rchime de novo example:
#> 
#>             starts ends nbases ambigs polymers numns   numseqs
#> Minimum:         1  249    249      0        3     0      1.00
#> 2.5%-tile:       1  252    252      0        4     0   2955.05
#> 25%-tile:        1  252    252      0        4     0  29550.50
#> Median:          1  253    253      0        4     0  59101.00
#> 75%-tile:        1  253    253      0        5     0  88651.50
#> 97.5%-tile:      1  254    254      0        6     0 115246.95
#> Maximum:         1  256    256      0        8     0 118202.00
#> Mean:            1  252    252      0        4     0  59101.14
#> 
#> scrap_summary:
#>       type      trash_code unique total
#> 1 sequence rchime_chimeras   3588 10453
#> 
#> Number of unique seqs: 2496 
#> Total number of seqs: 118202 
#> 
#> Total number of samples: 20 
#> Total number of custom reports: 1

data <- rchime(df)
#> ℹ The de novo method runs with a single processor.
#> → rchime removed `10453` chimeras from your dataset.
#> → It took `4.45368814468384` seconds to detect and remove the chimeras.
data
#>             starts ends nbases ambigs polymers numns   numseqs
#> Minimum:         1  249    249      0        3     0      1.00
#> 2.5%-tile:       1  252    252      0        4     0   2955.05
#> 25%-tile:        1  252    252      0        4     0  29550.50
#> Median:          1  253    253      0        4     0  59101.00
#> 75%-tile:        1  253    253      0        5     0  88651.50
#> 97.5%-tile:      1  254    254      0        6     0 115246.95
#> Maximum:         1  256    256      0        8     0 118202.00
#> Mean:            1  252    252      0        4     0  59101.14
#> 
#> scrap_summary:
#>       type      trash_code unique total
#> 1 sequence rchime_chimeras   3588 10453
#> 
#> Number of unique seqs: 2496 
#> Total number of seqs: 118202 
#> 
#> Total number of samples: 20 
#> Total number of custom reports: 1

Results

The rchime() function returns a strollur object. Let’s take a closer look at the chimera_report generated by rchime(). The chimera_report is a data.frame with a row for each sequence in your dataset. Let’s take a look at the first 5 chimeric sequences in the report:

chimera_report <- strollur::report(data, type = "chimera_report")

chimera_report[chimera_report$Chimeric_Status == "Y", ] |> head(n = 5)
#>        Score                                        Query
#> 66 0.3805621 M00967_43_000000000-A3JHG_1_1106_11629_14238
#> 70 0.5261480 M00967_43_000000000-A3JHG_1_1103_26580_14708
#> 80 0.5580357 M00967_43_000000000-A3JHG_1_2101_21700_24164
#> 89 0.3348214 M00967_43_000000000-A3JHG_1_1112_23980_19089
#> 91 0.6377551 M00967_43_000000000-A3JHG_1_2110_20944_24019
#>                                         ParentA
#> 66 M00967_43_000000000-A3JHG_1_1107_15750_18592
#> 70 M00967_43_000000000-A3JHG_1_2110_12856_16229
#> 80 M00967_43_000000000-A3JHG_1_1113_11294_24024
#> 89 M00967_43_000000000-A3JHG_1_1107_15750_18592
#> 91 M00967_43_000000000-A3JHG_1_2101_22400_13416
#>                                         ParentB
#> 66 M00967_43_000000000-A3JHG_1_2101_22400_13416
#> 70 M00967_43_000000000-A3JHG_1_1107_15750_18592
#> 80 M00967_43_000000000-A3JHG_1_2110_12856_16229
#> 89 M00967_43_000000000-A3JHG_1_1109_25348_18015
#> 91  M00967_43_000000000-A3JHG_1_1112_6862_18037
#>                                      Top_Parent        QM       QA       QB
#> 66 M00967_43_000000000-A3JHG_1_1107_15750_18592  99.60317 98.01587 94.44444
#> 70 M00967_43_000000000-A3JHG_1_2110_12856_16229 100.00000 97.61905 95.63492
#> 80 M00967_43_000000000-A3JHG_1_1113_11294_24024 100.00000 98.01587 94.44444
#> 89 M00967_43_000000000-A3JHG_1_1107_15750_18592 100.00000 98.80952 94.44444
#> 91 M00967_43_000000000-A3JHG_1_2101_22400_13416 100.00000 98.01587 93.65079
#>         QAB       QT LY LN LA RY RN RA      Div Chimeric_Status
#> 66 93.25397 98.01587 13  0  0  4  0  1 1.587302               Y
#> 70 93.25397 97.61905 11  0  0  6  0  0 2.380952               Y
#> 80 92.46032 98.01587 14  0  0  5  0  0 1.984127               Y
#> 89 93.25397 98.80952 14  0  0  3  0  0 1.190476               Y
#> 91 91.66667 98.01587 16  0  0  5  0  0 1.984127               Y

mirror server hosted at Truenetwork, Russian Federation.