Misha Basics (Short Guide)

This page gives a compact mental model for misha. Use it as the first quick read before the full Manual vignette.

The Core Idea

Most analyses follow the same pattern:

  1. Choose where to look (intervals / scope).
  2. Choose how to walk through it (iterator).
  3. Evaluate a track expression over those iterator intervals.

In misha this is usually one call to gextract, gscreen, or gsummary.

You are not limited to raw track names. You can pass full expressions, for example log(dense_track + 1), dense_track / (chip.sum + 1e-6), or pmin(dense_track, 2).

All examples below assume the bundled examples database:

library(misha)
gdb.init_examples()

Four Concepts You Need First

1) Track

A track is genomic signal organized over coordinates.

Useful starter commands:

gtrack.ls() # list tracks in the examples DB
#> [1] "array_track"         "dense_track"         "rects_track"        
#> [4] "sparse_track"        "subdir.dense_track2"
gtrack.info("dense_track") # inspect type/metadata
#> $type
#> [1] "dense"
#> 
#> $dimensions
#> [1] 1
#> 
#> $size.in.bytes
#> [1] 80012
#> 
#> $format
#> [1] "per-chromosome"
#> 
#> $bin.size
#> [1] 50
gtrack.info("sparse_track")
#> $type
#> [1] "sparse"
#> 
#> $dimensions
#> [1] 1
#> 
#> $size.in.bytes
#> [1] 32012
#> 
#> $format
#> [1] "per-chromosome"

For intuition, you can think of dense_track as a ChIP-seq-like coverage signal.

2) Intervals

An interval set defines genomic regions (chrom, start, end) where you want to work.

regions <- gintervals(1, c(0, 250000), c(100000, 260000))
regions
#>   chrom  start    end
#> 1  chr1      0 100000
#> 2  chr1 250000 260000

3) Iterator

The iterator is the stepping policy inside the scope.

Think of it as: scope says where, iterator says in what chunks.

out <- gextract("dense_track", regions, iterator = 100)
head(out)
#>   chrom start end dense_track intervalID
#> 1  chr1     0 100   0.1688889          1
#> 2  chr1   100 200   0.1700000          1
#> 3  chr1   200 300   0.1800000          1
#> 4  chr1   300 400   0.1600000          1
#> 5  chr1   400 500   0.1100000          1
#> 6  chr1   500 600   0.0400000          1
log_out <- gextract("log(dense_track + 1)", regions, iterator = 100)
head(log_out)
#>   chrom start end log(dense_track + 1) intervalID
#> 1  chr1     0 100           0.15605364          1
#> 2  chr1   100 200           0.15700375          1
#> 3  chr1   200 300           0.16551444          1
#> 4  chr1   300 400           0.14842000          1
#> 5  chr1   400 500           0.10436001          1
#> 6  chr1   500 600           0.03922071          1

Create and use an intervals set as an iterator:

gintervals.save("my_intervals_set", regions) # name first, then the intervals
out2 <- gextract("dense_track", gintervals.all(), iterator = "my_intervals_set")
out2
#>   chrom  start    end dense_track intervalID
#> 1  chr1      0 100000   0.1011889          1
#> 2  chr1 250000 260000   0.1263158          1

4) Virtual Track

A virtual track is a named on-the-fly transformation, not stored as a physical track file.

Examples:

gvtrack.create("chip.sum", "dense_track", "sum")
out <- gextract("chip.sum", regions, iterator = 200)
head(out)
#>   chrom start  end   chip.sum intervalID
#> 1  chr1     0  200 0.67777777          1
#> 2  chr1   200  400 0.68000001          1
#> 3  chr1   400  600 0.29999998          1
#> 4  chr1   600  800 0.04000000          1
#> 5  chr1   800 1000 0.09999999          1
#> 6  chr1  1000 1200 0.12000000          1

You can also shift the iterator window used by the virtual track:

gvtrack.create("chip.shifted", "dense_track", "sum")
gvtrack.iterator("chip.shifted", sshift = -100, eshift = 100)
out <- gextract("chip.shifted", regions, iterator = 200)
head(out)
#>   chrom start  end chip.shifted intervalID
#> 1  chr1     0  200     1.037778          1
#> 2  chr1   200  400     1.240000          1
#> 3  chr1   400  600     0.660000          1
#> 4  chr1   600  800     0.140000          1
#> 5  chr1   800 1000     0.200000          1
#> 6  chr1  1000 1200     0.220000          1

Here, each iterator interval is expanded by 100 bp on both sides before evaluating dense_track.

Virtual tracks are session objects (easy to list with gvtrack.ls and delete with gvtrack.rm).

Minimal Workflow

library(misha)
gdb.init_examples()

# 1) pick scope
regions <- gintervals(1, 0, 50000)

# 2) inspect available tracks
gtrack.ls()
#> [1] "array_track"         "dense_track"         "rects_track"        
#> [4] "sparse_track"        "subdir.dense_track2"

# 3) extract signal with a chosen iterator
chip <- gextract("dense_track", regions, iterator = 100)
head(chip)
#>   chrom start end dense_track intervalID
#> 1  chr1     0 100   0.1688889          1
#> 2  chr1   100 200   0.1700000          1
#> 3  chr1   200 300   0.1800000          1
#> 4  chr1   300 400   0.1600000          1
#> 5  chr1   400 500   0.1100000          1
#> 6  chr1   500 600   0.0400000          1

# 4) screen high-signal bins (as a simple peak-like filter).
#    Pick the threshold from the data: dense_track only reaches 0.34 in this
#    scope, so a threshold above that would silently screen nothing.
hi_chip <- gscreen("dense_track > 0.2", regions, iterator = 100)
head(hi_chip)
#>   chrom start   end
#> 1  chr1 17200 17300
#> 2  chr1 20000 20100
#> 3  chr1 23300 23400
#> 4  chr1 26200 26300
#> 5  chr1 32600 32800
#> 6  chr1 32900 33000

# 5) summarize distribution/coverage
gsummary("dense_track", regions, iterator = 100)
#> Total intervals   NaN intervals             Min             Max             Sum 
#>    500.00000000      0.00000000      0.00000000      0.34000000     43.68888862 
#>            Mean         Std dev 
#>      0.08737778      0.06208607

PWM in One Minute

A PWM/PSSM is a motif model over A/C/G/T. In misha, a common pattern is:

  1. Extract sequence from intervals.
  2. Score those sequences with a PWM.
regions <- gintervals(1, c(1000, 2000), c(1020, 2020))
seqs <- gseq.extract(regions)
seqs
#> [1] "cctcagtaatccgaaaagcc" "CTGCATGTAACTTAATACCA"

pssm <- matrix(c(
    0.80, 0.05, 0.10, 0.05,
    0.10, 0.10, 0.70, 0.10,
    0.05, 0.80, 0.05, 0.10,
    0.10, 0.10, 0.10, 0.70
), ncol = 4, byrow = TRUE)
colnames(pssm) <- c("A", "C", "G", "T")

scores <- gseq.pwm(seqs, pssm, mode = "lse")
scores
#> [1] -2.198000 -2.119781

If your database has motif files under pssms/, you can create a genome-wide PWM-energy track with gtrack.create_pwm_energy(...).

mirror server hosted at Truenetwork, Russian Federation.